SHENTEK® rcAAV Quantitation Kit is suitable for qPCR detection of replication-competent adeno-associated virus (rcAAV) from cell culture harvested bulk and purified stock. This Kit is designed for the quantification of rcAAV-5/N contamination in serotypes of rAAV-5/N (N stands for possible different capsid serotypes). The sample types include but are not limited to recombinant adeno-associated virus (rAAV) bulk and end-products, as well as harvested samples from cell culture desired for rcAAV detection.
Key information before using this kit:
1. AAV serotypes
2. The inverted terminal repeat (ITR) sequence of the test sample rAAV need to match the following sequences:
ITR sequence of rAAV-5/N
CTCTCCCCCCTGTCGCGTTCGCTCGCTCGCTGGCTCGTTTGGGGGGGTGG
CAGCTCAAAGAGCTGCCAGACGACGGCCCTCTGGCCGTCGCCCCCCCAA
ACGAGCCAGCGAGCGAGCGAACGCGACAGGGGGGAGAGTGCCACACTC
TCAAGCAAGGGGGT
| Components | Shipping Condition | Unit Size | Detection Method |
| T & R DNA Control - 5 | -20℃ | 100 reactions × 2 | Probe-based qPCR |
| rcAAV qPCR Reaction Buffer | -20℃, protect from light | ||
| Target Primer&Probe MIX-5 | |||
| Reference Primer&Probe MIX-5 | |||
| 100×ROX | |||
| DNA Dilution Buffer (DDB) | |||
| ddH2O | -20℃ |
| Range | Target-5: |
| Reference-5: | |
| Accuracy | Recovery = |
| LOQ | Target-5: |
| Reference-5: | |
| LOD | 8×10-1 copies/μL |
| Precision | / |
| Robustness | Freeze-thaw stability over 5 cycles |
| Instrument suitability not limited to Thermo, Biorad, Roche, SHENTEK qPCR equipments |
info@shentekbio.com 
English
