Medical Consumables and Lab Consumables OEM Manufacturer
Medical Consumables and Lab Consumables OEM Manufacturer

rcAAV-2/N Quantitation Kit

Product Number: 1403444

SHENTEK® rcAAV Quantitation Kit is suitable for qPCR detection of replication-competent adeno-associated virus (rcAAV) from cell culture harvested bulk and purified stock. This Kit is designed for the quantification of rcAAV-2/N contamination in serotypes of rAAV-2/N (N stands for possible different capsid serotypes). The sample types include but not limited to recombinant adeno-associated virus (rAAV) bulk and end-products, as well as harvested samples from cell culture desired for rcAAV detection.


Key information before using this kit:

1. AAV serotypes

2. The inverted terminal repeat (ITR) sequence of the test sample rAAV need to match the following sequences:

ITR sequence of rAAV-2/N

TTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACC

AAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAG

CGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT


Contact
Get Connected
Add to cart
Add to cart
rcaav assay

Overview - SHENTEK® rcAAV-2/N Quantitation Kit

ComponentsShipping ConditionUnit SizeDetection Method
T & R DNA Control-2-20℃100 reactions × 2Probe-based qPCR
rcAAV qPCR Reaction Buffer-20℃, protect from light
Target Primer&Probe MIX-2
Reference Primer&Probe MIX-2
100×ROX
DNA Dilution Buffer (DDB)
ddH2O-20℃






Specification - SHENTEK® rcAAV-2/N Quantitation Kit

RangeTarget-2: 5 - 2×106 copies/μL, R2= 0.99920, E=95.3%
Reference-2: 1×101 - 2×106 copies/μL, R2= 0.99966,E=100.8%
AccuracyRecovery = 96.6%-137.8%, CV<30%
LOQTarget-2: 5 copies/μL
Reference-2: 1×101 copies/μL
LOD4×10-1 copies/μL
Precision3.7%-13.0% (<30%)
RobustnessFreeze-thaw stability over 5 cycles
Instrument suitability not limited to Thermo, Biorad, Roche, SHENTEK qPCR equipments






Related Products

SHENTEK® Virus DNA & RNA Extraction Kit

SHENTEK® rcAAV-5/N Quantitation Kit

Products

Documents & Download

Certificate of Analysis
Connect with SHENTEK
Reliable and Trusted Partner For Biologics Quality Control Kits and Instruments
For Inquiries
Request a Quote
Add to cart Add to cart
Add to cart
Contact Us Now!
Certificate of Analysis
+
Product Number
Lot Number
Close
Add to Cart (0)
Empty
Inquire
We use cookies to offer you a better browsing experience, analyze site traffic and personalize content. By using this site, you agree to our use of cookies. Visit our cookie policy to learn more.
Reject Accept