SHENTEK® rcAAV Quantitation Kit is suitable for qPCR detection of replication-competent adeno-associated virus (rcAAV) from cell culture harvested bulk and purified stock. This Kit is designed for the quantification of rcAAV-2/N contamination in serotypes of rAAV-2/N (N stands for possible different capsid serotypes). The sample types include but not limited to recombinant adeno-associated virus (rAAV) bulk and end-products, as well as harvested samples from cell culture desired for rcAAV detection.
Key information before using this kit:
1. AAV serotypes
2. The inverted terminal repeat (ITR) sequence of the test sample rAAV need to match the following sequences:
ITR sequence of rAAV-2/N
TTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACC
AAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAG
CGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT
| Components | Shipping Condition | Unit Size | Detection Method |
| T & R DNA Control-2 | -20℃ | 100 reactions × 2 | Probe-based qPCR |
| rcAAV qPCR Reaction Buffer | -20℃, protect from light | ||
| Target Primer&Probe MIX-2 | |||
| Reference Primer&Probe MIX-2 | |||
| 100×ROX | |||
| DNA Dilution Buffer (DDB) | |||
| ddH2O | -20℃ |
| Range | Target-2: 5 - 2×106 copies/μL, R2= 0.99920, E=95.3% |
| Reference-2: 1×101 - 2×106 copies/μL, R2= 0.99966，E=100.8% | |
| Accuracy | Recovery = 96.6%-137.8%, CV<30% |
| LOQ | Target-2: 5 copies/μL |
| Reference-2: 1×101 copies/μL | |
| LOD | 4×10-1 copies/μL |
| Precision | 3.7%-13.0% (<30%) |
| Robustness | Freeze-thaw stability over 5 cycles |
| Instrument suitability not limited to Thermo, Biorad, Roche, SHENTEK qPCR equipments |
info@shentekbio.com 
English
